Top » Catalog » SNPs » BY2693

$18.00

BY2693
[BY2693]

BY2693
hg38 Position: ChrY:17340320..17340320
Ancestral: G
Derived: A
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: .
Forward Primer: BY2693_F GGAATTACATTTGCAGTAAGGAGATC
Reverse Primer: BY2693_R TGGATAATTTAAATTACAAAAATGACCTC
Reviews

Customers who bought this product also purchased
A5381
A5381
BY248
BY248
BY246
BY246
R1b-MC14_BY246 Panel
R1b-MC14_BY246 Panel
BY2689
BY2689
A5383
A5383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies