Top » Catalog » SNPs » L26

$18.00

L26
[L26]

L26
hg38 Position: ChrY:20781011..20781011
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1
Comments: .
Forward Primer: L26_F GCATGTGTGTTTTGGTGGAG
Reverse Primer: L26_R TCCTTGAGGGTCAGAGGAAG
Reviews

Customers who bought this product also purchased
Y3620
Y3620
L227
L227
FGC21373
FGC21373
CTS10083
CTS10083
CTS3818
CTS3818
Z421
Z421
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies