Top » Catalog » SNPs » L26

$18.00

L26
[L26]

L26
hg38 Position: ChrY:20781011..20781011
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1
Comments: .
Forward Primer: L26_F GCATGTGTGTTTTGGTGGAG
Reverse Primer: L26_R TCCTTGAGGGTCAGAGGAAG
Reviews

Customers who bought this product also purchased
Y29011
Y29011
FGC56202
FGC56202
Y84796
Y84796
Y8531
Y8531
Y22063
Y22063
M205
M205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies