Top » Catalog » SNPs » L26

$18.00

L26
[L26]

L26
hg38 Position: ChrY:20781011..20781011
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1
Comments: .
Forward Primer: L26_F GCATGTGTGTTTTGGTGGAG
Reverse Primer: L26_R TCCTTGAGGGTCAGAGGAAG
Reviews (1)

Customers who bought this product also purchased
Z2454
Z2454
Y45447
Y45447
Y47299
Y47299
PF5416
PF5416
CTS11251
CTS11251
PF5012
PF5012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies