Top » Catalog » SNPs » L26

$18.00

L26
[L26]

L26
hg38 Position: ChrY:20781011..20781011
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1
Comments: .
Forward Primer: L26_F GCATGTGTGTTTTGGTGGAG
Reverse Primer: L26_R TCCTTGAGGGTCAGAGGAAG
Reviews

Customers who bought this product also purchased
Y22060
Y22060
Z575
Z575
PH2514
PH2514
M241
M241
A11525
A11525
J2b-M12 Panel
J2b-M12 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies