Top » Catalog » SNPs » A5388

$18.00

A5388
[A5388]

A5388
hg38 Position: ChrY:7037350..7037350
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S588
Forward Primer: A5388_F GTCTAGGAGGGCATGACATTTG
Reverse Primer: A5388_R TGCAACAGAAACCACTAAGGTG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
DF49
DF49
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
A16088
A16088
FGC64966
FGC64966
BY13680
BY13680
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies