Top » Catalog » SNPs » A5392

$18.00

A5392
[A5392]

A5392
hg38 Position: ChrY:2928162..2928162
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A5392_F TTTCATGTATACCTTTCACCTATTTC
Reverse Primer: A5392_R GATAAAAATGGAGGGGAAAATC
Reviews

Customers who bought this product also purchased
YSEQ-Delta
YSEQ-Delta
A10245
A10245
A10244
A10244
FGC15270
FGC15270
FGC15278
FGC15278
FGC15274
FGC15274
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies