Top » Catalog » SNPs » A5392

$18.00

A5392
[A5392]

A5392
hg38 Position: ChrY:2928162..2928162
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A5392_F TTTCATGTATACCTTTCACCTATTTC
Reverse Primer: A5392_R GATAAAAATGGAGGGGAAAATC
Reviews

Customers who bought this product also purchased
A10245
A10245
A10244
A10244
FGC15278
FGC15278
FGC15274
FGC15274
FGC15270
FGC15270
A5394
A5394
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies