Top » Catalog » SNPs » A5396

$18.00

A5396
[A5396]

A5396
hg38 Position: ChrY:7729204..7729204
Ancestral: C
Derived: T
Reference: Lyn-David McMullen (2015)
ISOGG Haplogroup: R1b1a2a1a1c1 (not listed)
Comments: Native Irish Co. Down. Monaghan
Forward Primer: A5396_F CTTACTTTAGGCAGGTATTTTAACAAGCT
Reverse Primer: A5396_R GAGTTTTGACCCACTTAAAGAGTGA
Reviews

Customers who bought this product also purchased
R1b-Z156 Irish Orientation Panel
R1b-Z156 Irish Orientation Panel
FGC11697
FGC11697
FGC11661
FGC11661
FGC14326
FGC14326
S5556
S5556
FGC11674
FGC11674
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies