Top » Catalog » SNPs » A5396

$18.00

A5396
[A5396]

A5396
hg38 Position: ChrY:7729204..7729204
Ancestral: C
Derived: T
Reference: Lyn-David McMullen (2015)
ISOGG Haplogroup: R1b1a2a1a1c1 (not listed)
Comments: Native Irish Co. Down. Monaghan
Forward Primer: A5396_F CTTACTTTAGGCAGGTATTTTAACAAGCT
Reverse Primer: A5396_R GAGTTTTGACCCACTTAAAGAGTGA
Reviews

Customers who bought this product also purchased
FGC11661
FGC11661
FGC14326
FGC14326
S5556
S5556
FGC11674
FGC11674
S5520
S5520
M7033
M7033
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies