Top » Catalog » SNPs » FGC11661

$18.00

FGC11661
[FGC11661]

FGC11661
hg38 Position: ChrY:7964366..7964366
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1
Comments: Isles and Rhine Basin
Forward Primer: FGC11661_F TTTTAAGATGGAGTCTGTCACCC
Reverse Primer: FGC11661_R TTTCTGGTTCAGCATTTAGGTG
Reviews

Customers who bought this product also purchased
R1b-Z156 Irish Orientation Panel
R1b-Z156 Irish Orientation Panel
Z304
Z304
FGC11697
FGC11697
A5396
A5396
S5556
S5556
FGC14326
FGC14326
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies