Top » Catalog » SNPs » FGC11661

$15.00

FGC11661
[FGC11661]

FGC11661
hg38 Position: ChrY:7964366..7964366
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1
Comments: Isles and Rhine Basin
Forward Primer: FGC11661_F TTTTAAGATGGAGTCTGTCACCC
Reverse Primer: FGC11661_R TTTCTGGTTCAGCATTTAGGTG
Reviews

Customers who bought this product also purchased
FGC11697
FGC11697
A5396
A5396
S5556
S5556
FGC14326
FGC14326
S5520
S5520
FGC11674
FGC11674
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies