Top » Catalog » SNPs » FGC11674

$18.00

FGC11674
[FGC11674]

FGC11674
hg38 Position: ChrY:13371021..13371021
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1 (not listed)
Comments: Branch point Irish Maolain to Scotland
Forward Primer: FGC11674_F CGAGGTGGCATATGTCTGTC
Reverse Primer: FGC11674_R TACGGGAAGAGCTGTCAGTG
Reviews

Customers who bought this product also purchased
Z306
Z306
DF96
DF96
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
DF98
DF98
Z301
Z301
Z381
Z381
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies