Top » Catalog » SNPs » FGC11697

$18.00

FGC11697
[FGC11697]

FGC11697
hg38 Position: ChrY:21318551..21318551
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1 (not listed)
Comments: Link to Rhine Basin
Forward Primer: FGC11697v2_F GATGGATATGGCAGAAGTCAGC
Reverse Primer: FGC11697v2_R AATGTGCAGGTTAGTTACATATGTATACC
Reviews

Customers who bought this product also purchased
S5556
S5556
FGC14326
FGC14326
S5520
S5520
FGC11674
FGC11674
Z156
Z156
M7033
M7033
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies