Top » Catalog » SNPs » FGC11697

$18.00

FGC11697
[FGC11697]

FGC11697
hg38 Position: ChrY:21318551..21318551
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1 (not listed)
Comments: Link to Rhine Basin
Forward Primer: FGC11697v2_F GATGGATATGGCAGAAGTCAGC
Reverse Primer: FGC11697v2_R AATGTGCAGGTTAGTTACATATGTATACC
Reviews

Customers who bought this product also purchased
S5520
S5520
FGC11674
FGC11674
Z156
Z156
M7033
M7033
R1b-Z156 Irish Orientation Panel
R1b-Z156 Irish Orientation Panel
Z304
Z304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies