Top » Catalog » SNPs » FGC14326

$18.00

FGC14326
[FGC14326]

FGC14326
hg38 Position: ChrY:13710287..13710287
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a1c1
Comments: Native Irish Tyrone Laois Dublin Kilkenny
Forward Primer: FGC14326_F CCACACTTTTGGCCATATTTC
Reverse Primer: FGC14326_R TGACAAGAACCAACTGATTTCC
Reviews

Customers who bought this product also purchased
R1b-Z156 Irish Orientation Panel
R1b-Z156 Irish Orientation Panel
FGC11697
FGC11697
FGC11661
FGC11661
A5396
A5396
S5556
S5556
FGC11674
FGC11674
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies