Top » Catalog » SNPs » FGC14326

$18.00

FGC14326
[FGC14326]

FGC14326
hg38 Position: ChrY:13710287..13710287
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a1c1
Comments: Native Irish Tyrone Laois Dublin Kilkenny
Forward Primer: FGC14326_F CCACACTTTTGGCCATATTTC
Reverse Primer: FGC14326_R TGACAAGAACCAACTGATTTCC
Reviews

Customers who bought this product also purchased
S5556
S5556
FGC11674
FGC11674
S5520
S5520
M7033
M7033
Z156
Z156
Z304
Z304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies