Top » Catalog » SNPs » S5520

$18.00

S5520
[S5520]

S5520
hg38 Position: ChrY:16923829..16923829
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1b
Comments: Branching predominantly isles
Forward Primer: S5520_F TGAGCACCAATATGCCATTC
Reverse Primer: S5520_R TCTCCCATCTCAGCCTCTTG
Reviews

Customers who bought this product also purchased
A9580
A9580
Y18100
Y18100
S1911
S1911
FGC39806
FGC39806
M343
M343
FGC39801
FGC39801
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies