Top » Catalog » SNPs » S5556

$18.00

S5556
[S5556]

S5556
hg38 Position: ChrY:22223757..22223757
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1b1
Comments: Branching predominantly isles
Forward Primer: S5556_F GGAGGCTGACAGAAGAAGGTG
Reverse Primer: S5556_R ACAATGTAGTTGGGTGGCG
Reviews

Customers who bought this product also purchased
Z301
Z301
Z381
Z381
FGC11660
FGC11660
Z18
Z18
FGC11662
FGC11662
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies