Top » Catalog » SNPs » S5556

$18.00

S5556
[S5556]

S5556
hg38 Position: ChrY:22223757..22223757
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1b1
Comments: Branching predominantly isles
Forward Primer: S5556_F GGAGGCTGACAGAAGAAGGTG
Reverse Primer: S5556_R ACAATGTAGTTGGGTGGCG
Reviews

Customers who bought this product also purchased
FGC11660
FGC11660
Z18
Z18
FGC11662
FGC11662
L48
L48
DF96
DF96
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies