Top » Catalog » SNPs » Z156

$18.00

Z156
[Z156]

Z156
hg38 Position: ChrY:13668461..13668461
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1
Comments: upstream of L1. downstream of U106;downstream of Z381; parallel to Z301
Forward Primer: Z156_F CTTAGTAACCCAGATTCCCAGTG
Reverse Primer: Z156_R TCCTTCATCTTGTGTTTACTCCTG
Reviews

Customers who bought this product also purchased
FGC39815
FGC39815
FT363853
FT363853
BY118350
BY118350
FGC60496
FGC60496
FTA16931
FTA16931
FGC39800
FGC39800
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies