Top » Catalog » SNPs » Z156

$18.00

Z156
[Z156]

Z156
hg38 Position: ChrY:13668461..13668461
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1
Comments: upstream of L1. downstream of U106;downstream of Z381; parallel to Z301
Forward Primer: Z156_F CTTAGTAACCCAGATTCCCAGTG
Reverse Primer: Z156_R TCCTTCATCTTGTGTTTACTCCTG
Reviews

Customers who bought this product also purchased
FGC8512
FGC8512
JFS0001
JFS0001
S1686
S1686
FGC12305
FGC12305
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
DF89
DF89
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies