Top » Catalog » SNPs » Z304

$18.00

Z304
[Z304]

Z304
hg38 Position: ChrY:11931607..11931607
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1a
Comments: Downstream of Z156 Branching Spain/NW France/S Briton/Ireland
Forward Primer: Z304_F ATAATGGCAAAAACCGCGATTAT
Reverse Primer: Z304_R ACAAAACGTCAATTTGAAGAGTGTTC
Reviews

Customers who bought this product also purchased
S1894
S1894
A7197
A7197
S1911
S1911
A13232
A13232
S22069
S22069
FGC14776
FGC14776
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies