Top » Catalog » SNPs » Z304

$18.00

Z304
[Z304]

Z304
hg38 Position: ChrY:11931607..11931607
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1a
Comments: Downstream of Z156 Branching Spain/NW France/S Briton/Ireland
Forward Primer: Z304_F ATAATGGCAAAAACCGCGATTAT
Reverse Primer: Z304_R ACAAAACGTCAATTTGAAGAGTGTTC
Reviews

Customers who bought this product also purchased
Z156
Z156
FGC11674
FGC11674
R1b-Z156 Irish Orientation Panel
R1b-Z156 Irish Orientation Panel
FGC11697
FGC11697
FGC11661
FGC11661
S5556
S5556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies