Top » Catalog » SNPs » Z304

$15.00

Z304
[Z304]

Z304
hg38 Position: ChrY:11931607..11931607
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1a
Comments: Downstream of Z156 Branching Spain/NW France/S Briton/Ireland
Forward Primer: Z304_F ATAATGGCAAAAACCGCGATTAT
Reverse Primer: Z304_R ACAAAACGTCAATTTGAAGAGTGTTC
Reviews

Customers who bought this product also purchased
FGC11661
FGC11661
S5556
S5556
A5396
A5396
S5520
S5520
FGC14326
FGC14326
Z156
Z156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies