Top » Catalog » SNPs » FGC19845

$18.00

FGC19845
[FGC19845]

FGC19845
hg38 Position: ChrY:15129265..15129265
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. DF97
Forward Primer: FGC19845_F GCACAATTCTTTGCATGTTTTAG
Reverse Primer: FGC19845_R CCTGCCTACCTTAAATGTTCTTG
Reviews

Customers who bought this product also purchased
FGC33214
FGC33214
FGC19842
FGC19842
FGC30115
FGC30115
FGC19852
FGC19852
FGC19851
FGC19851
S659
S659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies