Top » Catalog » SNPs » A5409

$18.00

A5409
[A5409]

A5409
hg38 Position: ChrY:13163987..13163987
Ancestral: A
Derived: G
Reference: David R Moore (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > L1403
Forward Primer: A5409_F TGAGCCTTCTGAGTTGCTAGG
Reverse Primer: A5409_R TGGAAAGGATACTGGGAGTCAG
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
CTS3655
CTS3655
A426
A426
FGC3213
FGC3213
L1446
L1446
A421
A421
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies