Top » Catalog » SNPs » A5411

$18.00

A5411
[A5411]

A5411
hg38 Position: ChrY:22314362..22314362
Ancestral: T
Derived: G
Reference: Paul Burns (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Leinster Z255 Byrne cluster
Forward Primer: A5411_F GGGACACTGAAACTTTTAAATTAGTGAC
Reverse Primer: A5411_R GAAGGGCTTCTGCTTCTTGAG
Reviews

Customers who bought this product also purchased
A5905
A5905
A1163
A1163
Z255
Z255
Z16950
Z16950
BY2573
BY2573
L159.2
L159.2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies