Top » Catalog » SNPs » Z140

$18.00

Z140
[Z140]

Z140
hg38 Position: ChrY:15751475..15751475
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1a
Comments: downstream of I1. parallel to L22
Forward Primer: Z140_F TTGTTCCTGGCTACCCTGTC
Reverse Primer: Z140_R ACTTGAACCTGGGTGGCA
Reviews

Customers who bought this product also purchased
S2077
S2077
Y2245.2
Y2245.2
I1-Z63 "Continental" Panel
I1-Z63 "Continental" Panel
A14608
A14608
FGC23806
FGC23806
A11152
A11152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies