Top » Catalog » SNPs » Z140

$18.00

Z140
[Z140]

Z140
hg38 Position: ChrY:15751475..15751475
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1a
Comments: downstream of I1. parallel to L22
Forward Primer: Z140_F TTGTTCCTGGCTACCCTGTC
Reverse Primer: Z140_R ACTTGAACCTGGGTGGCA
Reviews

Customers who bought this product also purchased
S7660
S7660
FGC33034
FGC33034
CTS2208
CTS2208
Y29628
Y29628
Y11203
Y11203
Y4741
Y4741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies