Top » Catalog » SNPs » Z140

$18.00

Z140
[Z140]

Z140
hg38 Position: ChrY:15751475..15751475
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1a
Comments: downstream of I1. parallel to L22
Forward Primer: Z140_F TTGTTCCTGGCTACCCTGTC
Reverse Primer: Z140_R ACTTGAACCTGGGTGGCA
Reviews

Customers who bought this product also purchased
A14608
A14608
FGC23806
FGC23806
A11152
A11152
S26062
S26062
BY232
BY232
S2122
S2122
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies