Top » Catalog » SNPs » BY2606

$18.00

BY2606
[BY2606]

BY2606
HG19 Position: ChrY:2814451..2814451
Ancestral: T
Derived: C
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: .
Forward Primer: BY2606_F AAGCAATCCAATCACCTTGG
Reverse Primer: BY2606_R CTGGCCACCAAACCCTATC
Reviews

Customers who bought this product also purchased
Z18039
Z18039
BY337
BY337
DF49
DF49
FGC11203
FGC11203
ZP80
ZP80
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies