Top » Catalog » SNPs » BY2606

$18.00

BY2606
[BY2606]

BY2606
HG19 Position: ChrY:2946410..2946410
Ancestral: T
Derived: C
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Below DF49
Forward Primer: BY2606_F AAGCAATCCAATCACCTTGG
Reverse Primer: BY2606_R CTGGCCACCAAACCCTATC
Reviews

Customers who bought this product also purchased
ZP80
ZP80
Z39589
Z39589
Z2961
Z2961
BY485
BY485
DF13
DF13
Z2980
Z2980
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies