Top » Catalog » SNPs » BY2606

$18.00

BY2606
[BY2606]

BY2606
hg38 Position: ChrY:2946410..2946410
Ancestral: T
Derived: C
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Below DF49
Forward Primer: BY2606_F AAGCAATCCAATCACCTTGG
Reverse Primer: BY2606_R CTGGCCACCAAACCCTATC
Reviews

Customers who bought this product also purchased
Z2980
Z2980
A11232
A11232
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
M222
M222
BY838
BY838
A10103
A10103
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies