Top » Catalog » SNPs » A5580

$18.00

A5580
[A5580]

A5580
hg38 Position: ChrY:16854410..16854410
Ancestral: G
Derived: A
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below P312
Forward Primer: A5580_F CCTGCTTTCCTGTCTTCCTG
Reverse Primer: A5580_R TTGCAAAGCCAAGGTATGC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A441
A441
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies