Top » Catalog » SNPs » A5581

$18.00

A5581
[A5581]

A5581
hg38 Position: ChrY:21227880..21227880
Ancestral: C
Derived: T
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below P312
Forward Primer: A5581_F CTCGGCTTACTGCAACCC
Reverse Primer: A5581_R TGGGGAATCAAGATCTACCG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A436
A436
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies