Top » Catalog » SNPs » A5583

$18.00

A5583
[A5583]

A5583
hg38 Position: ChrY:9974465..9974465
Ancestral: G
Derived: A
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312
Forward Primer: A5583_F GGAGAAGGAGGGAGAAAGGTG
Reverse Primer: A5583_R CCTTTTGTAAATGGTCTAGTGGGAG
Reviews

Customers who bought this product also purchased
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A789
A789
A788
A788
A434
A434
A433
A433
A5586
A5586
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies