Top » Catalog » SNPs » A5584

$18.00

A5584
[A5584]

A5584
hg38 Position: ChrY:15868059..15868059
Ancestral: G
Derived: A
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312
Forward Primer: A5584_F CATTCACTCCCATCATCTCG
Reverse Primer: A5584_R TCAGGCTGATCTATCACAGGG
Reviews

Customers who bought this product also purchased
A788
A788
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A789
A789
A446
A446
A434
A434
A433
A433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies