Top » Catalog » SNPs » A5585

$18.00

A5585
[A5585]

A5585
hg38 Position: ChrY:16503539..16503539
Ancestral: T
Derived: G
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312
Forward Primer: A5585_F GCTAGTAGTCAGTAAAGGACAGAAGC
Reverse Primer: A5585_R GGATAGCAAACTTGGGAGAATC
Reviews

Customers who bought this product also purchased
A789
A789
A788
A788
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
DNA Sample Kit
DNA Sample Kit
A5583
A5583
A446
A446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies