Top » Catalog » SNPs » A5585

$18.00

A5585
[A5585]

A5585
hg38 Position: ChrY:16503539..16503539
Ancestral: T
Derived: G
Reference: Paul Mize (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312
Forward Primer: A5585_F GCTAGTAGTCAGTAAAGGACAGAAGC
Reverse Primer: A5585_R GGATAGCAAACTTGGGAGAATC
Reviews

Customers who bought this product also purchased
A789
A789
A788
A788
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A433
A433
A5586
A5586
A431
A431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies