Top » Catalog » SNPs » DF89

$17.50

DF89
[DF89]

DF89
HG19 Position: ChrY:18555998..18555998
Ancestral: T
Derived: C
Reference: Andy Gierson
ISOGG Haplogroup: R1b, not listed
Comments: Downstream U198/S29, parallel to DF93
Forward Primer: DF89_F CAGCTCAGCAACCTGTACG
Reverse Primer: DF89_R CTTTATTTTGAATGGTGTAAATGTAGAC
Reviews (1)

Customers who bought this product also purchased
Z301
Z301
S15627
S15627
Z381
Z381
S1687
S1687
L48
L48
S1686
S1686
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10861
1 x A10517
1 x A11227
1 x A10282
1 x A10846
1 x A1153
1 x A10514
1 x A10986
1 x A10882
1 x A11119
1 x A11520
1 x A10112
1 x A10894
1 x A10218
1 x A11679
1 x A11778
1 x A10965
1 x A10647
1 x A11656
1 x A11728
1 x A10737
1 x A10707
1 x A10130
1 x A11586
1 x A11519
1 x A11118
1 x A10879
1 x A11492
1 x A10864
1 x A11530
1 x A10841
1 x A10164
1 x A10772
1 x A1105
1 x A10643
1 x A10009
1 x A10497
1 x A10424
1 x A10163
1 x A11769
1 x A10313
1 x A11674
1 x A10317
1 x A10516
1 x A11077
1 x A1158
1 x A1170
1 x A11777
1 x A11482
1 x A10721
1 x A10058
1 x A11688
1 x A10773
1 x A10600
1 x A10940
1 x A11551
1 x A11239
1 x A11528
1 x A10730
$1,032.50
Haplogroup Info
Other products
Currencies