Top » Catalog » SNPs » DF89

$18.00

DF89
[DF89]

DF89
hg38 Position: ChrY:16444118..16444118
Ancestral: T
Derived: C
Reference: Andy Gierson
ISOGG Haplogroup: R1b
Comments: Downstream U198/S29. parallel to DF93
Forward Primer: DF89_F CAGCTCAGCAACCTGTACG
Reverse Primer: DF89_R CTTTATTTTGAATGGTGTAAATGTAGAC
Reviews (1)

Customers who bought this product also purchased
Z18
Z18
DF96
DF96
Y14201
Y14201
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
DF98
DF98
S16994
S16994
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies