Top » Catalog » SNPs » DF89

$18.00

DF89
[DF89]

DF89
hg38 Position: ChrY:16444118..16444118
Ancestral: T
Derived: C
Reference: Andy Gierson
ISOGG Haplogroup: R1b
Comments: Downstream U198/S29. parallel to DF93
Forward Primer: DF89_F CAGCTCAGCAACCTGTACG
Reverse Primer: DF89_R CTTTATTTTGAATGGTGTAAATGTAGAC
Reviews (1)

Customers who bought this product also purchased
U106
U106
L51
L51
JFS0001
JFS0001
P312
P312
FGC12305
FGC12305
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies