Top » Catalog » SNPs » S10360

$18.00

S10360
[S10360]

S10360
hg38 Position: ChrY:7702076..7702076
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a3a1a1b
Comments: .
Forward Primer: S10360_F GTTTCATGAGAAATAACAGCTGTCTC
Reverse Primer: S10360_R GAAAACCCTGATGTCCCATG
Reviews

Customers who bought this product also purchased
M172
M172
Y8467
Y8467
M253
M253
Y2245
Y2245
P126
P126
Z2041
Z2041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies