Top » Catalog » SNPs » S10360

$18.00

S10360
[S10360]

S10360
hg38 Position: ChrY:7702076..7702076
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a3a1a1b
Comments: .
Forward Primer: S10360_F GTTTCATGAGAAATAACAGCTGTCTC
Reverse Primer: S10360_R GAAAACCCTGATGTCCCATG
Reviews

Customers who bought this product also purchased
Z140
Z140
Z2539
Z2539
L22
L22
I1 Superclade Panel
I1 Superclade Panel
FGC39940
FGC39940
M253
M253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies