Top » Catalog » SNPs » Y6228

$18.00

Y6228
[Y6228]

Y6228
hg38 Position: ChrY:21415329..21415329
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I1a3a1a1b1a
Comments: .
Forward Primer: Y6228_F TCTTGTCACCAATAAAAGTCATCG
Reverse Primer: Y6228_R ACTATGCCTGAAGATGACATTTCA
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y2245.2
Y2245.2
Y3976
Y3976
Y7666
Y7666
S15301
S15301
S2097
S2097
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies