Top » Catalog » SNPs » Y6228

$18.00

Y6228
[Y6228]

Y6228
hg38 Position: ChrY:21415329..21415329
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I1a3a1a1b1a
Comments: .
Forward Primer: Y6228_F TCTTGTCACCAATAAAAGTCATCG
Reverse Primer: Y6228_R ACTATGCCTGAAGATGACATTTCA
Reviews

Customers who bought this product also purchased
L22
L22
FGC39940
FGC39940
I1 Superclade Panel
I1 Superclade Panel
FGC9532
FGC9532
Z63
Z63
Z140
Z140
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies