Top » Catalog » SNPs » Y7626

$18.00

Y7626
[Y7626]

Y7626
hg38 Position: ChrY:13866454..13866454
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I1-Y6229
Comments: Aka BY316
Forward Primer: Y7626_F TATATGATAAATACGGCAGTACAAAATAAC
Reverse Primer: Y7626_R CACATCCCCTAAATTTCTCAGTCA
Reviews

Customers who bought this product also purchased
FGC9532
FGC9532
Z63
Z63
Z140
Z140
Z2539
Z2539
FGC39940
FGC39940
L22
L22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies