Top » Catalog » SNPs » A5616

$18.00

A5616
[A5616]

A5616
hg38 Position: ChrY:12100880..12100880
Ancestral: G
Derived: A
Reference: Andrew Booth (2015)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a1a1
Comments: Downstream from Z12.
Forward Primer: A5616_F TGAAGGAGTGGTGACATACACC
Reverse Primer: A5616_R GATATATTTGGCATCCATCTCTGAC
Reviews

Customers who bought this product also purchased
A10942
A10942
A10940
A10940
A10938
A10938
A10947
A10947
A10937
A10937
A10944
A10944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies