Top » Catalog » SNPs » A5616

$18.00

A5616
[A5616]

A5616
hg38 Position: ChrY:12100880..12100880
Ancestral: G
Derived: A
Reference: Andrew Booth (2015)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a1a1
Comments: Downstream from Z12.
Forward Primer: A5616_F TGAAGGAGTGGTGACATACACC
Reverse Primer: A5616_R GATATATTTGGCATCCATCTCTGAC
Reviews

Customers who bought this product also purchased
A10937
A10937
A10944
A10944
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
A10943
A10943
A10942
A10942
A10940
A10940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies