Top » Catalog » SNPs » L657

$18.00

L657
[L657]

L657
hg38 Position: ChrY:12039158..12039158
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b2a1
Comments: Found in a hg R-Z93 WTY participant
Forward Primer: L657_F AGGCTTGCCTCAAACTCTTG
Reverse Primer: L657_R GCATCGCTCACACTGGAAG
Reviews

Customers who bought this product also purchased
BY69508
BY69508
FT368646
FT368646
Y878
Y878
DC169
DC169
BY70730
BY70730
Y52775
Y52775
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies