Top » Catalog » SNPs » L657

$18.00

L657
[L657]

L657
hg38 Position: ChrY:12039158..12039158
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b2a1
Comments: Found in a hg R-Z93 WTY participant
Forward Primer: L657_F AGGCTTGCCTCAAACTCTTG
Reverse Primer: L657_R GCATCGCTCACACTGGAAG
Reviews

Customers who bought this product also purchased
BY60768
BY60768
BY162940
BY162940
FT22438
FT22438
Y56311
Y56311
Y174532
Y174532
Y43850
Y43850
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies