Top » Catalog » SNPs » L657

$18.00

L657
[L657]

L657
hg38 Position: ChrY:12039158..12039158
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b2a1
Comments: Found in a hg R-Z93 WTY participant
Forward Primer: L657_F AGGCTTGCCTCAAACTCTTG
Reverse Primer: L657_R GCATCGCTCACACTGGAAG
Reviews

Customers who bought this product also purchased
CTS6
CTS6
Y2630
Y2630
YP5480
YP5480
M458
M458
FGC18218
FGC18218
FGC18226
FGC18226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies