Top » Catalog » SNPs » L657

$18.00

L657
[L657]

L657
hg38 Position: ChrY:12039158..12039158
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b2a1
Comments: Found in a hg R-Z93 WTY participant
Forward Primer: L657_F AGGCTTGCCTCAAACTCTTG
Reverse Primer: L657_R GCATCGCTCACACTGGAAG
Reviews

Customers who bought this product also purchased
Z92
Z92
L664
L664
R1a-Z280 Panel
R1a-Z280 Panel
M417
M417
Z282
Z282
S24902
S24902
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies