Top » Catalog » SNPs » Y2632

$18.00

Y2632
[Y2632]

Y2632
hg38 Position: ChrY:7303725..7303725
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b (not listed)
Comments: Below Z2123 > Y20746
Forward Primer: Y2632v2_F GCATATGTGGGTGTGCTCTC
Reverse Primer: Y2632v2_R TCGACAGAGGTCATTAAGTCTCCT
Reviews

Customers who bought this product also purchased
Z93
Z93
L62
L62
R1a Superclade Panel
R1a Superclade Panel
YP4907
YP4907
SUR51
SUR51
Y20746
Y20746
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies