Top » Catalog » SNPs » Z2122

$18.00

Z2122
[Z2122]

Z2122
hg38 Position: ChrY:12356666..12356666
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1a1a1b2a2b
Comments: downstream of Z93;Z94;Z95; parallel to Z96 and Z2123; downstream of Z2121
Forward Primer: Z2122_F GAGATATTAGGGAGGGCTAGAGTG
Reverse Primer: Z2122_R CACCCTTTTTAAGGAAGCCCTT
Reviews

Customers who bought this product also purchased
M12280
M12280
Z93
Z93
M417
M417
R1a Superclade Panel
R1a Superclade Panel
YP1127
YP1127
Y2631
Y2631
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies