Top » Catalog » SNPs » Z93

$18.00

Z93
[Z93]

Z93
hg38 Position: ChrY:7684315..7684315
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z93_F CAAACAAAAATAAGAGTCACATTATGC
Reverse Primer: Z93_R CAACAATGTCAAAGAATCATGATTC
Reviews

Customers who bought this product also purchased
YP5250
YP5250
YP5253
YP5253
Y132956
Y132956
YP5945
YP5945
Y37292
Y37292
YP5950
YP5950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies