Top » Catalog » SNPs » Z93

$18.00

Z93
[Z93]

Z93
hg38 Position: ChrY:7684315..7684315
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z93_F CAAACAAAAATAAGAGTCACATTATGC
Reverse Primer: Z93_R CAACAATGTCAAAGAATCATGATTC
Reviews

Customers who bought this product also purchased
YP5917
YP5917
CTS8816
CTS8816
BY25698
BY25698
YP1364
YP1364
YP415
YP415
L1029
L1029
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies